RARE DISEASERESEARCH ATLAS
Open navigation menu

ORPHA:94058

Neovascular glaucoma

high confidenceDisorder

Publications

6,509

93.3th percentile

Trials

31

Interventional, condition-specific

Researchers

941

Distinct authors in sample

Gene link

—

Readiness

4/6

Stages with a signal

Clinical definition (Orphanet)

Neovascular glaucoma is the most common type of secondary glaucoma, usually caused by diabetic retinopathy, central retinal vein occlusion and carotid artery obstruction but sometimes by trauma, uveitis or ocular tumors, and characterized by severe eye pain, synechial angle glaucoma, high intraocular pressure and leading to loss of vision.

How rare: 1-5 / 10 000 — about one to five people per ten thousand (still uncommon, but less ultra-rare).

Orphanet entry

Cross-references

Joined from Mondo / Orphanet. MeSH labels may enter searches; UMLS / OMIM / NCIT are stored for reference.

Research stages

Trial readiness signals

Where this condition sits on an open-data research pipeline — not how close a treatment is, and not medical advice. Empty stages often mean “not in these databases under this Mondo ID,” not “impossible.”

4/6 stages with a signal

An interventional trial matched this condition name on ClinicalTrials.gov — see trials below.

  1. Gene identifiedNot found

    No GenCC disease–gene assertion in this build

  2. LiteraturePresent

    6,509 matched papers (3,749 in last 10 years) Source

  3. Phenotype characterisedPresent

    20 HPO annotations (e.g. Retinal venous occlusion; Retinopathy; Ocular pain) Source

  4. Animal modelNot found

    No Alliance genotype “model of” associations via Monarch for these Mondo IDs

  5. Orphan designationPartial

    1 EMA designation (none yet with FDA orphan-indication approval) — e.g. antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Source

  6. Interventional trialPresent

    31 matched on ClinicalTrials.gov (1 recruiting in sample)

Biology

Genes and phenotypes

Gene–disease validity from GenCC, plus phenotypes and animal models joined from Monarch Initiative via Mondo ID — not a clinical diagnosis aid.

Do we know what causes it?

Not yet — the cause hasn't been pinned down in GenCC.

No strong gene–disease assertion joined for this Orphanet entity.

Phenotypes (Monarch / HPO)

20

Associated phenotypes · MONDO:0019783

  • Retinal venous occlusion
  • Retinopathy
  • Ocular pain
  • Abnormality of central retinal artery
  • Abnormal anterior chamber morphology

Showing 5 of 20 — open Monarch for the full list.

Animal models (Monarch / Alliance)

None returned for this Mondo ID. Empty here is not proof that no model organism work exists under another name or gene.

Monarch fetch 2026-07-29

Therapies

Designations, candidates, and chemicals

FDA OOPD and EMA orphan designations, Open Targets clinical candidates, and CTD chemical associations via MyDisease.info. These never change the interventional-trial headline.

Orphan designation (FDA · EMA)

1

Designation · no FDA orphan-indication approval yet

  • EMA antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)Treatment of neovascular glaucoma · 02/10/2003 · PositiveEMA designation

Sources: FDA OOPD · EMA orphan designations

Open Targets candidates

4

Drugs / clinical candidates · MONDO_0019783

CTD chemicals (MyDisease.info)

No CTD chemical associations returned for this Mondo ID.

Literature

Is anyone studying this?

6,509

6,509 papers — among the better-studied rare conditions, though still a fraction of common-disease literature (breast cancer: over 700,000). Median papers in the last 10 years for a rare disease in this dataset (publications denominator n=3967) is 59.

6,509 papers since the earliest indexed year in this search — median last-10-year count for a rare disease in this dataset is 59 (publications denominator n=3967).

3,749 in the last 10 years · high confidence · 93.3th percentile (publications denominator)

Phrase hits: 6,507 · MeSH hits: 24

Open Europe PMC search

Who's working on it?

941

Distinct author names in 200 sampled papers — named people below.

Who's working on it?

People publishing on this condition (sampled Europe PMC records). Affiliation is the most recent found in that sample.

  1. 01
    Liu Y5 papers · 2026

    Department of Ophthalmology, the Second Affiliated Hospital of Xi'an Medical University, Xi'an 710038, Shaanxi Province, China.

    Papers in Europe PMC
  2. 02
    Chen Y4 papers · 2026

    Eye Hospital Wenzhou Medical University at Zhijiang, 366# Xiangshan, Zhuanzhi Road, Hangzhou, 310024, Zhejiang, China.

    Papers in Europe PMC
  3. 03
    He Y4 papers · 2026

    Shaanxi Eye Hospital, Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University, No. 21 Jiefang Road, Xi'an, Shaanxi, 710004, China.

    Papers in Europe PMC
  4. 04
    Inoue T4 papers · 2026

    Japan Glaucoma Society, Tokyo, Japan.

    Papers in Europe PMC
  5. 05
    Zhang S4 papers · 2026

    American Academy of Ophthalmology, San Francisco, California.

    Papers in Europe PMC
  6. 06
    Zhang X4 papers · 2026

    Department of Ophthalmology, The Sixth Medical Centre of Chinese People's Liberation Army General Hospital, No.6 Fucheng Road, Haidian District, Beijing, China.

    Papers in Europe PMC
  7. 07
    Inatani M3 papers · 2026

    Department of Ophthalmology, Faculty of Medical Sciences, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Eiheiji, Yoshida, Fukui, 910-1193, Japan. inatani@u-fukui.ac.jp.

    Papers in Europe PMC
  8. 08
    Li G3 papers · 2026

    Department of Ophthalmology, The First Affiliated Hospital of Shantou University Medical College, No. 57 Changping Road, Shantou, 515041, China.

    Papers in Europe PMC
  9. 09
    Tanito M3 papers · 2026

    Japan Glaucoma Society, Tokyo, Japan.

    Papers in Europe PMC
  10. 10
    Wang Y3 papers · 2026

    Department of Ophthalmology, Chongqing Aier Eye Hospital, Chongqing, China. wangyieye@aliyun.com.

    Papers in Europe PMC

Clinical research

Is a treatment being tested?

31

interventional trials for this specific condition

31 interventional trials matched this specific condition name; 1 currently recruiting in our sample. 1,568 trials are registered for glaucoma, the broader category — shown separately because they may or may not enrol this specific subtype.

Data as of 11 September 2026

31 interventional trials — more than 77.2% of diseases in the trials denominator have none at all (5501 of 7126; this disease is at the 96.1th percentile).

high confidence · 96.1th percentile (trials denominator)

Recruiting interventional trials

From the matched ClinicalTrials.gov set

31 interventional trials matched after quoted-phrase search and title/condition post-filter.

Broader category: glaucoma

1,568

Interventional trials for the parent category, exclusive of NCT IDs already counted above. Eligibility for this subtype is not guaranteed.

Worth raising with a clinician. How we count trials.

Recruiting under the broader category

Observational and natural-history studies

5 observational studies match this condition. These do not test a treatment and are not counted in the interventional-trial headline, but they are genuine research: natural-history work often defines the endpoints needed for a future rare-disease trial, and families may be able to enroll.

Recruiting or not-yet-recruiting

Open the complete matched search on ClinicalTrials.gov

Other registries (secondary)

Broader net from EU CTIS, ISRCTN, and ICTRP when available — deduped against ClinicalTrials.gov IDs already counted above. Dual-model LLM relevance gates what we keep. These rows are not added to the interventional headline.

raw 27 · after dedupe 27 · already on CT.gov 0 · kept 0 · parent 0 · uncertain 27 · dropped 0 · fetched 2026-07-30

Source notes: ictrp: Error: ICTRP public search unavailable (WHO portal is SPA-only; SOAP needs partnership). Tried: https://apps.who.int/tri

No secondary-registry studies passed dual-model relevance for this condition name (after dedupe).

Uncertain / not reviewed (27)

Where to find support

Condition-specific patient organisations, when Orphanet lists them, are on the disease’s Orphanet page. We also link umbrella groups that support undiagnosed and ultra-rare families.

Orphanet entry for Neovascular glaucoma — check Associations / patient organisations on that page.

India — NPRD

Last verified 2026-07-26

This ORPHAcode is not on our curated NPRD list (direct or Mondo-parent match). That does not decide clinical eligibility; families in India should ask a notified Centre of Excellence about current coverage.

Hand-curated for this project. ORPHAcode mappings are best-effort and may be incomplete or imprecise for umbrella categories. Parent (Mondo) matches mean the policy lists a broader category — confirm eligibility with a Centre of Excellence. Financial entitlements summarised from public policy statements and may change. This is not official government guidance.

How we counted this

Europe PMC query (preferred label + any corrected label + Orphanet and Mondo exact synonyms, stoplisted; unioned with resolved MeSH labels when available). UMLS / OMIM / NCIT cross-references are stored on the overview but are not added to the query string.

"Neovascular glaucoma"

Run this search on Europe PMC

MeSH descriptor terms unioned into the query: Glaucoma, Neovascular

ClinicalTrials.gov query (quoted phrases + MeSH via query.cond, plus recall-expansion terms when used):

"Neovascular glaucoma" OR "Glaucoma, Neovascular"

Interventional trials matched via: both, phrase, mesh (mesh = registered under a MeSH descriptor no name phrase would catch; recall-expansion = gene / selected parent terms used only for trials).

Study-type breakdown: 31 interventional · 5 observational · 0 expanded access. Only interventional studies enter the trial headline.

Parent-category trials query:

"glaucoma"

Query health: ok — strategies attempted: phrase, mesh; with hits: phrase, mesh

Run this search on ClinicalTrials.gov

Confidence reasoning

  • Preferred label is multi-word and distinctive
  • No synonyms dropped by stoplist
  • No label/synonym collisions with other diseases in this corpus

Ingested 2026-07-27T04:36:04.404Z